Determining Evolutionary Relatedness Using Amino Acid and Nucleic Acid Sequence Homology 

Lesson Objectives

In this lesson, students should answer the two following questions:

  • Are human proteins and DNA similar to other primates?
  • Can the similarities and differences show evolutionary relatedness?

Overview

 

Utilizing the vast databases available on the internet, it is possible to compare both proteins and DNA from many organisms.  By doing so, we are able to determine similarities between species.  In a protein sequence analysis, for example, the more amino acids that match up, the more closely related the two species will be.   These similarities can direct us in producing phylogenetic trees, or a visual depiction of the relatedness of species.  But often, the analysis of a single protein or gene sequence is not sufficient to provide an accurate picture of phylogeny.  In this exercise, we will utilize a modern analysis tool called BIOLOGY WORKBENCH (http://workbench.sdsc.edu/).  We will explore these protein and nucleic acid sequences and draw conclusions for ourselves regarding the kinship of primates.

 

Using Biology Workbench to compare amino acid sequences (modified from an online tutorial by Paul Lock, Urbana High School, “Comparing Primate Proteins”, http://peptide.ncsa.uiuc.edu/tutorials_current/Anthropology/)

In this exercise we will look at 8 organisms and compare the sequences of amino acids in the protein molecule MYOGLOBIN derived from each organism (although you can choose other molecules such as HEMOGLOBIN as well.)  Myoglobin is found in the muscle tissue of animals.  It is smaller than hemoglobin making it easier to count and compare the amino acids in multiple sequences.

 

1. Begin by opening your browser to the website at (http://workbench.sdsc.edu/) and register to access the program.  Registration is free.  Click on SESSION TOOLS, then click on NEW.  Name your session "primate myoglobin", or whatever you like.  Click on START NEW SESSION.  Once this has been done, select PROTEIN TOOLS.   In Protein tools we will begin by clicking on NDJINN (pronounced like “engine”), which provides a multiple database listing. You will find this option on the lower toolbar (or pulldown menu).  This is like a web search engine similar to YAHOO! or HOTBOT only it looks through protein databases.

 

2. You will be presented with a long list of databases from which to choose.  Choose PDBFINDER and PIR by selecting the appropriate check buttons.  Then type MYOGLOBIN in the search box. Then click SEARCH.

 

3. You will be presented with a long list of organisms from which you may select.  Table 1 below lists the species we wish to compare.  Find these organisms on the list and select them with the check box beside the name.  Note the code given to each organism and write it down on the chart below.  This will assist in reading the alignment and phylogenetic tree.

 

4.  After checking the organisms you wish to compare, click on IMPORT SEQUENCES.

 

Table 1: Codes given to organisms studied in lab.

 

Organism

Code Number

Human

 

Chimpanzee

 

Mountain Gorilla

 

Olive Baboon

 

Weasel Lemur

 

Dog

 

Chicken

 

Port Jackson Shark

 

 

5. You are now presented with a list of your choices.  Click on SELECT ALL to chose all organisms to be compared.  On the toolbar below, select CLUSTALW.   Click on SUBMIT.  Your alignment will appear as a color coded sequences.  The colors in the alignment (as specified) will indicate the amino acids which match up completely or are “fully conserved.”  You will also see those that are partially conserved or show no similarity at all (no color).  In addition, a dendrogram, or phylogenetic tree, showing possible evolutionary relationships will be displayed. You may choose, prior to SUBMIT, to display either an unrooted or a rooted tree.

 

 

 

Analysis of Results

 

1.  Scroll down and look at the sequences for each organism.  Each letter represents an amino acid in its place in the sequence. What we need to do is compare them to each other.  Click on IMPORT ALIGNMENT.

 

2. Check the box next to the CLUSTALW set (your list of organisms). Click on BOXSHADE in the toolbar.  When a new page appears, go to the bottom and click on SUBMIT.

 

3. A beautiful colored array of amino acid sequences should appear. Completely Conserved and Partially Conserved portions are colored in green and yellow respectively. Teal indicates the next more closely related amino acids. We're interested in those non-colored (or non-green, non-similar) areas. They represent the places where changes in amino acid sequences have evolved. Subtle differences in the species have accumulated due to mutations of the DNA sequence.  By examining the alignments you have achieved, fill in the table below by comparing each organisms’ sequence to the human sequence at the top.  Determine the number of amino acids that do not match the human sequence.

 

 

 

Table 2: Similarities and differences in the amino acid sequences of myoglobin

 

 

 

 

 

 

 

Comparative

Organism

Number of amino acid matching human

Number of amino acids not matching human 

Human vs.

Chimpanzee

 

 

 

Mt. Gorilla

 

 

 

Olive Baboon

 

 

 

Lemur

 

 

 

Dog

 

 

 

Chicken

 

 

 

Shark

 

 

 

 

 

9. Complete Table 3  by using the numbers gathered above and then calculating the percent conservation, or the percentage of amino acids that are the same and fall in the same position on the sequence for each organism compared to human. Row 1 has been done for you.

 

 

Table3: Percentage of conserved amino acids of select organisms compared to human

 

 

Organism

 

A. Number of Similar Amino Acid Positions Complete Conservation or Matching Semi-Conserved areas

B. Number of Different Amino Acid Positions Non-Conserved areas

Percentage of Conserved Amino Acids

=(Column A/ total A+B amino acids *100%)

Human vs.

Chimpanzee

 152

 2

 98.7%

 

Mt. Gorilla

 

 

 

 

Olive Baboon

 

 

 

 

Lemur

 

 

 

 

Dog

 

 

 

 

Chicken

 

 

 

 

A Shark

 

 

 

Evolutionary Differences

Examine the table above.  From the data gathered in this alignment, can you determine which primate is most closely related to humans?  Which organism is the most distant relation?  Explain your reasoning. 

Your data should show that both gorilla and chimpanzee possess only two amino acids that are different from humans.  Therefore, we cannot discern, using only myoglobin amino acid sequences, which is more closely related. 

In order to clarify this question, we may choose to run another protein sequence comparison.  But proteins are relatively stable over time compared to their DNA counterparts.  A variety of codons may code for the same amino acid.  Therefore, the DNA sequences for similar proteins may look very different from their protein products. 

To help us to distinguish between gorilla and chimpanzee as the closest evolutionary relative to humans, we will chose to give ourselves another point of reference.  A wise choice would be the D-loop of mitochondrial DNA.  This region is “hypervariable” meaning it mutates quickly.  Therefore, any evolutionary changes of a recent nature will be apparent.

 Using Biology Workbench to compare nucleic acid sequences (modified from an online tutorial by Scott Cooper, University of Wisconsin, “Generation of Phylogenetic Tree based upon DNA sequence analysis”,  http://bioweb.uwlax.edu/GenWeb/Evol_Pop/Phylogenetics/Exercise/exercise.htm)

You will follow exactly the same procedure as you did with amino acids with a few changes

1.       You will open a new session, maybe call it “primate D-loop”.  Click on START NEW SESSION.

2.       Click on NUCLEIC TOOLS (rather than protein tools).

3.       Now, instead of using the Ndjinn search engine, you will enter your own DNA sequences.  You will copy one of the sequences from below (nucleic acid code only: A,T,C,G only).  To copy any of the sequences onto your computer’s clipboard in order to paste the sequence into the workbench (see below), you can access this document at: http://www.clunet.edu/BioDev/marcey/biol_282/homology_lab.doc. Go to the workbench and click on ADD.  A window will appear in which you can paste your DNA sequence.  Label it as human, gorilla or chimp.  Repeat for each sample provided below.  Since human, gorilla and chimp are the organisms we wish to focus on, it is good to limit them in this search.  Once all are entered, click on  SELECT ALL, then CLUSTALW, then SUBMIT, then IMPORT ALIGNMENTS. 

4.       You have the option of selecting DRAWTREE which will show you a phylogenetic tree based upon your alignments.  You may choose a rooted or unrooted tree. You may also select BOXSHADE once again to give you a clear picture of the nucleic acids that are conserved.  From this, you might choose to produce another data table like table 3, or you can draw inferences directly from the boxshade graph.  Now you should be able to determine whether gorillas or chimpanzees are more closely related to humans. 

 

 

 FINAL ANALYSIS

Based on your protein sequence data and your further probe with mitochondrial DNA, can you now determine which primate is most closely related to humans?  Explain your reasoning.

Can you construct a phylogenetic tree incorporating inferences made from both sequence analyses? 

Does this information support fossil and anatomical evidence for great ape evolution?

D-loop hypervariable region sequences from three primate species.

Human

>gi|975204|emb|X90314.1|MTHSWGICB H.sapiens mitochondrial DNA for D-loop (isolate WG+ice37+B)
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCA

 

Gorilla

>gi|3766221|gb|AF089820.1|AF089820 Gorilla gorilla beringei mitochondrial D-loop, partial sequence
TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATGTCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCACAAACACTCCCCCACCTATAATACATTACCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTACATAATACATAAAATCATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCCCCTTCAGATAGGGATCCCTTAAACACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACCTGG

 

Chimpanzee

>gi|6288860|gb|AF176766.1|AF176766 Pan troglodytes troglodytes isolate DODO mitochondrial D-loop, partial sequence
GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAACCACTCAACTACCTATAATACATTAAGCCCACCCCCACATTACAACCTCCACCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACACCCCTCTCCCACCCCGATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCGCACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGG